least squares fit of the single site, association equation (graphpad prism) Search Results


gene exp gusb hs99999908 m1  (Thermo Fisher)
99
Thermo Fisher gene exp gusb hs99999908 m1
Gene Exp Gusb Hs99999908 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/Gene+Exp%2E+GUSB%2C+Hs99999908_m1/pm31433987-535-88-93
Average 99 stars, based on 1 article reviews
gene exp gusb hs99999908 m1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
comsol ab  (Oxford Instruments)
99
Oxford Instruments comsol ab
Comsol Ab, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/Imaris/pm30017246-250-189-192
Average 99 stars, based on 1 article reviews
comsol ab - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
image studio lite li cor v5 2 image lab bio rad v6 0 las af leica v2 7 9723 3 prism graphpad v8 0 2 16 cell reports 44  (Bio-Rad)
99
Bio-Rad image studio lite li cor v5 2 image lab bio rad v6 0 las af leica v2 7 9723 3 prism graphpad v8 0 2 16 cell reports 44
Image Studio Lite Li Cor V5 2 Image Lab Bio Rad V6 0 Las Af Leica V2 7 9723 3 Prism Graphpad V8 0 2 16 Cell Reports 44, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/Image+Lab+Software/pm40056414-608-236-243
Average 99 stars, based on 1 article reviews
image studio lite li cor v5 2 image lab bio rad v6 0 las af leica v2 7 9723 3 prism graphpad v8 0 2 16 cell reports 44 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
aav9 software  (Addgene inc)
94
Addgene inc aav9 software
(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. <t>AAV9–mediated</t> transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.
Aav9 Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/pAAV%2EhSyn%2EeGFP%2EWPRE%2EbGH+(Plasmid+%23105539)/pmc07271821-861-242-241
Average 94 stars, based on 1 article reviews
aav9 software - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
ps100001 software  (OriGene)
96
OriGene ps100001 software
(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. <t>AAV9–mediated</t> transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.
Ps100001 Software, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/pCMV6-Entry+Mammalian+Expression+Vector/pm34624218-299-148-146
Average 96 stars, based on 1 article reviews
ps100001 software - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
pcdna3 1 3xha calm1  (Addgene inc)
95
Addgene inc pcdna3 1 3xha calm1
(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. <t>AAV9–mediated</t> transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.
Pcdna3 1 3xha Calm1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/pUC57-sgRNA+expression+vector+(Plasmid+%2351132)/pm36417862-249-168-175
Average 95 stars, based on 1 article reviews
pcdna3 1 3xha calm1 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier
1687 human hek293 cytion 300192 software  (CLS Cell Lines Service GmbH)
96
CLS Cell Lines Service GmbH 1687 human hek293 cytion 300192 software
(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. <t>AAV9–mediated</t> transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.
1687 Human Hek293 Cytion 300192 Software, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/HEK293+Cells/pm39368091-576-206-209
Average 96 stars, based on 1 article reviews
1687 human hek293 cytion 300192 software - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
paper n a lenticrispr v2 sanjana  (Addgene inc)
96
Addgene inc paper n a lenticrispr v2 sanjana
(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. <t>AAV9–mediated</t> transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.
Paper N A Lenticrispr V2 Sanjana, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/lentiCRISPR+v2+(Plasmid+%2352961)/pm33606996-269-137-145
Average 96 stars, based on 1 article reviews
paper n a lenticrispr v2 sanjana - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
algorithms fiji imagej version 1 0 shindeline  (Addgene inc)
92
Addgene inc algorithms fiji imagej version 1 0 shindeline
(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. <t>AAV9–mediated</t> transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.
Algorithms Fiji Imagej Version 1 0 Shindeline, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/PCRII-zSynA+(Plasmid+%2320121)/pm36334595-223-164-160
Average 92 stars, based on 1 article reviews
algorithms fiji imagej version 1 0 shindeline - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
v 1.4.1103  (RStudio)
90
RStudio v 1.4.1103
(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. <t>AAV9–mediated</t> transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.
V 1.4.1103, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/v+1+4+1106/pmc10063157__mmc2-254-208-211
Average 90 stars, based on 1 article reviews
v 1.4.1103 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
graph pad prism graphpad  (Proteintech)
94
Proteintech graph pad prism graphpad
(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. <t>AAV9–mediated</t> transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.
Graph Pad Prism Graphpad, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/PELI1+Antibody/pm37498743-244-43-60
Average 94 stars, based on 1 article reviews
graph pad prism graphpad - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
1687 human hek293 cytion 300192 software  (ATCC)
99
ATCC 1687 human hek293 cytion 300192 software
(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. <t>AAV9–mediated</t> transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.
1687 Human Hek293 Cytion 300192 Software, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/least+squares+fit+of+the+single+site%2C+association+equation+(graphpad+prism)/BxPC-3/pm39368091-576-206-201
Average 99 stars, based on 1 article reviews
1687 human hek293 cytion 300192 software - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results


(A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. AAV9–mediated transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: (A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. AAV9–mediated transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Isolation, Fluorescence, In Situ Hybridization, Staining, Transduction, Injection, Infection

Data and Software Availability

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, DNA Extraction, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing Assay, Expressing